mutations in gyrB using denaturing high performance liquid chromatography


Detection of mutations in gyrB utilizing denaturing excessive efficiency liquid chromatography (DHPLC) amongst Salmonella enterica serovar Typhi and Paratyphi A.

Fluoroquinolone resistance is mediated by mutations within the quinolone-resistance figuring out area (QRDR) of the topoisomerase genes. Denaturing excessive efficiency liquid chromatography (DHPLC) was evaluated for detection of clinically essential mutations in gyrB amongst Salmonella.

Salmonella Typhi and S. Paratyphi A characterised for mutation in QRDR of gyrA, parC and parE had been studied for mutation in gyrB by DHPLC and validated by sequencing.

The DHPLC evaluation was capable of resolve the take a look at mutant from isolates with wild sort gyrB and distinguished mutants from different mutant by peak profile and shift in retention time. Three sequence variants had been detected at codon 464, and a novel mutation Ser→Thr was additionally detected. gyrB mutation was related to non classical quinolone resistance (NALS-CIPDS) in 34 isolates of S. Typhi solely and was distinct from classical quinolone resistance related to gyrA mutations (NALR-CIPDS).

Setup of a Protocol of Molecular Analysis of β-Thalassemia Mutations in Tunisia utilizing Denaturing Excessive-Efficiency Liquid Chromatography (DHPLC)


β-Thalassemia is likely one of the most prevalent worldwide autosomal recessive problems. It presents a terrific molecular heterogeneity ensuing from greater than 200 causative mutations within the β-globin gene. In Tunisia, β-thalassemia represents essentially the most prevalent monogenic hemoglobin dysfunction with 2.21% of carriers.

Environment friendly and dependable mutation-screening strategies are important with the intention to set up applicable prevention applications for in danger {couples}. The goal of the current research is to develop an environment friendly methodology based mostly on the denaturing high-performance liquid chromatography (DHPLC) through which the entire β-globin gene (HBB) is screened for mutations masking about 90% of the spectrum.


We now have carried out the validation of a DHPLC assay for direct genotyping of 11 identified β-thalassemia mutations within the Tunisian inhabitants.


DHPLC assay was established based mostly on the evaluation of 62 archival β-thalassemia samples beforehand genotyped then validated with full concordance on 50 checks with blind randomized samples beforehand genotyped with DNA sequencing and with 96% of consistency on 40 samples as a potential research.


In comparison with different genotyping strategies, the DHPLC methodology can meet the necessities of direct genotyping of identified β-thalassemia mutations in Tunisia and to be utilized as a robust instrument for the genetic screening of prenatal and postnatal people.


Recombinant Zyxin (ZYX)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q15942
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Zyxin expressed in: E.coli

Human Zyxin (ZYX)

  • EUR 293.00
  • EUR 963.00
  • EUR 409.00
  • EUR 717.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 65.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Zyxin(ZYX) expressed in Mammalian cell

Zyxin (ZYX) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Zyxin (ZYX) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Zyxin (ZYX) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Zyxin (ZYX) Antibody

abx037464-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Zyxin (ZYX) Antibody

  • EUR 342.00
  • EUR 857.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Zyxin (ZYX) Antibody

abx239764-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Zyxin (ZYX) Antibody

abx239765-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Zyxin (ZYX) Antibody

abx433465-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Zyxin (ZYX) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Zyxin (ZYX) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Zyxin (ZYX) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Zyxin (ZYX) Antibody (Biotin)

  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Zyxin (ZYX) Antibody (FITC)

  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Zyxin(ZYX) ELISA kit

CSB-EL027165HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Zyxin (ZYX) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Zyxin(ZYX) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Zyxin(ZYX) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Zyxin (ZYX) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human ZYX/ Zyxin ELISA Kit

E2725Hu 1 Kit
EUR 605

Human Zyxin, ZYX ELISA KIT

ELI-53492h 96 Tests
EUR 824

Human Zyxin (ZYX) ELISA Kit

abx555876-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Human Zyxin (ZYX) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Zyxin(ZYX)ELISA Kit

GA-E1505HM-48T 48T
EUR 289

Human Zyxin(ZYX)ELISA Kit

GA-E1505HM-96T 96T
EUR 466

Zyxin (ZYX) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Cys384~Thr572)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX)

Zyxin (ZYX) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Asn377~Val523)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX)

Zyxin (ZYX) Monoclonal Antibody (Human)

  • EUR 255.00
  • EUR 2642.00
  • EUR 655.00
  • EUR 322.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX)

Human Zyxin(ZYX)ELISA Kit

QY-E04229 96T
EUR 361

Human Zyxin (ZYX) ELISA Kit

SEC235Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Zyxin (ZYX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Zyxin (ZYX) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Zyxin (ZYX) ELISA Kit

SEC235Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Zyxin (ZYX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Zyxin (ZYX) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Zyxin (ZYX) ELISA Kit

SEC235Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Zyxin (ZYX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Zyxin (ZYX) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Zyxin (ZYX) ELISA Kit

SEC235Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Zyxin (ZYX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Zyxin (ZYX) in tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Zyxin (ZYX) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Zyxin elisa. Alternative names of the recognized antigen: ESP2
  • HED2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Zyxin (ZYX) in samples from tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Zyxin ELISA Kit (ZYX)

RK02541 96 Tests
EUR 521

Chicken Zyxin, ZYX ELISA KIT

ELI-14746c 96 Tests
EUR 928

Chicken Zyxin (ZYX) ELISA Kit

abx555364-96tests 96 tests
EUR 911
  • Shipped within 1-3 weeks.

Mouse Zyxin (ZYX) ELISA Kit

abx556120-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Mouse Zyxin, Zyx ELISA KIT

ELI-40811m 96 Tests
EUR 865

ELISA kit for Human ZYX (Zyxin)

ELK4891 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Zyxin (ZYX). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Zyxin (ZYX). Next, Avi
  • Show more
Description: A sandwich ELISA kit for detection of Zyxin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Zyxin (ZYX)

KTE62447-48T 48T
EUR 332
  • Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Zyxin (ZYX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Zyxin (ZYX)

KTE62447-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Zyxin (ZYX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Zyxin (ZYX)

KTE62447-96T 96T
EUR 539
  • Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Zyxin (ZYX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Zyxin (ZYX) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Cys384~Thr572)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC.

Zyxin (ZYX) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Cys384~Thr572)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Biotin.

Zyxin (ZYX) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Cys384~Thr572)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Cy3.

Zyxin (ZYX) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Cys384~Thr572)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with FITC.

Zyxin (ZYX) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Cys384~Thr572)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with HRP.

Zyxin (ZYX) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Cys384~Thr572)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with PE.

Zyxin (ZYX) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Asn377~Val523)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC.

Zyxin (ZYX) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Asn377~Val523)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Biotin.

Zyxin (ZYX) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Asn377~Val523)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Cy3.

Zyxin (ZYX) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Asn377~Val523)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with FITC.

Zyxin (ZYX) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Asn377~Val523)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with HRP.

Zyxin (ZYX) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Asn377~Val523)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with PE.

Zyxin (ZYX) Monoclonal Antibody (Human), APC

  • EUR 358.00
  • EUR 3455.00
  • EUR 957.00
  • EUR 458.00
  • EUR 224.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC.

Zyxin (ZYX) Monoclonal Antibody (Human), Biotinylated

  • EUR 320.00
  • EUR 2592.00
  • EUR 760.00
  • EUR 394.00
  • EUR 223.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Biotin.

Zyxin (ZYX) Monoclonal Antibody (Human), Cy3

  • EUR 435.00
  • EUR 4565.00
  • EUR 1235.00
  • EUR 569.00
  • EUR 258.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with Cy3.

Zyxin (ZYX) Monoclonal Antibody (Human), FITC

  • EUR 306.00
  • EUR 2784.00
  • EUR 786.00
  • EUR 386.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with FITC.

Zyxin (ZYX) Monoclonal Antibody (Human), HRP

  • EUR 327.00
  • EUR 3011.00
  • EUR 846.00
  • EUR 413.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with HRP.

Zyxin (ZYX) Monoclonal Antibody (Human), PE

  • EUR 306.00
  • EUR 2784.00
  • EUR 786.00
  • EUR 386.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with PE.

Zyxin (ZYX) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Cys384~Thr572)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC-Cy7.

Zyxin (ZYX) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: ZYX (Asn377~Val523)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC-Cy7.

Zyxin (ZYX) Monoclonal Antibody (Human), APC-Cy7

  • EUR 596.00
  • EUR 6790.00
  • EUR 1795.00
  • EUR 796.00
  • EUR 329.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Zyxin (ZYX). This antibody is labeled with APC-Cy7.

Zyxin Phospho-Ser142 (ZYX pS142) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Zyx ELISA Kit| Mouse Zyxin ELISA Kit

EF016536 96 Tests
EUR 689

ZYX ELISA Kit| chicken Zyxin ELISA Kit

EF012568 96 Tests
EUR 689

ZYX Recombinant Protein (Human)

RP036337 100 ug Ask for price

ZYX Recombinant Protein (Rat)

RP238847 100 ug Ask for price

ZYX Recombinant Protein (Mouse)

RP188411 100 ug Ask for price

Alleleustrious pmTFP1-Zyxin fusion vector Zyxin

ABP-FP-TZY 5 ug Ask for price
    • Product line: Plasmids
    • Brand: Organelle Markers

Alleleustrious pWasabi-Zyxin fusion vector Zyxin

ABP-FP-WZY 5 ug Ask for price
    • Product line: Plasmids
    • Brand: Organelle Markers

Zyxin Antibody

39205-100ul 100ul
EUR 390

Zyxin Antibody

49705-100ul 100ul
EUR 333

Zyxin Antibody

49705-50ul 50ul
EUR 239

Zyxin Antibody

AF7902 200ul
EUR 376
Description: Zyxin Antibody detects endogenous levels of Zyxin.

Zyxin Antibody

AF7903 200ul
EUR 376
Description: Zyxin Antibody detects endogenous levels of Zyxin.


YF-PA15457 50 ul
EUR 363
Description: Mouse polyclonal to Zyxin


YF-PA15458 50 ug
EUR 363
Description: Mouse polyclonal to Zyxin


YF-PA15459 100 ug
EUR 403
Description: Rabbit polyclonal to Zyxin


YF-PA25007 50 ul
EUR 334
Description: Mouse polyclonal to Zyxin

ZYX antibody

70R-21425 50 ul
EUR 435
Description: Rabbit polyclonal ZYX antibody

ZYX antibody

38377-100ul 100ul
EUR 252

ZYX Antibody

43893-100ul 100ul
EUR 252

ZYX Antibody

DF6858 200ul
EUR 304
Description: ZYX Antibody detects endogenous levels of total ZYX.

ZYX Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ZYX. Recognizes ZYX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ZYX Antibody

ABD6858 100 ug
EUR 438

Recombinant Human Zyxin Protein, His, Mammal-100ug

QP10108-ma-100ug 100ug
EUR 1178

Recombinant Human Zyxin Protein, His, Mammal-20ug

QP10108-ma-20ug 20ug
EUR 462

Recombinant Human Zyxin Protein, His, Mammal-50ug

QP10108-ma-50ug 50ug
EUR 862

Human Zyxin ELISA kit

E01Z0034-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Zyxin ELISA kit

E01Z0034-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Zyxin ELISA kit

E01Z0034-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Zyxin ELISA KIT|Human

EF004535 96 Tests
EUR 689

Human ZYX shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Zyxin antibody (Ser142)

70R-34606 100 ug
EUR 327
Description: Purified Rabbit polyclonal Zyxin antibody (Ser142)

Zyxin Conjugated Antibody

C49705 100ul
EUR 397

Zyxin Blocking Peptide

AF7902-BP 1mg
EUR 195

Zyxin Blocking Peptide

AF7903-BP 1mg
EUR 195

anti- Zyxin antibody

FNab09764 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: zyxin
  • Uniprot ID: Q15942
  • Gene ID: 7791
  • Research Area: Cell Division and Proliferation, Signal Transduction
Description: Antibody raised against Zyxin

anti- Zyxin antibody

FNab09765 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: zyxin
  • Uniprot ID: Q15942
  • Gene ID: 7791
  • Research Area: Cell Division and Proliferation, Signal Transduction
Description: Antibody raised against Zyxin

Anti-Zyxin antibody

PAab09764 100 ug
EUR 412

Anti-Zyxin (2D1)

YF-MA11026 100 ug
EUR 363
Description: Mouse monoclonal to Zyxin

ZYX Blocking Peptide

DF6858-BP 1mg
EUR 195

ZYX Conjugated Antibody

C43893 100ul
EUR 397

ZYX Conjugated Antibody

C38377 100ul
EUR 397

ZYX cloning plasmid

CSB-CL027165HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1719
  • Sequence: atggcggccccccgcccgtctcccgcgatctccgtttcggtctcggctccggctttttacgccccgcagaagaagttcggccctgtggtggccccaaagcccaaagtgaatcccttccggcccggggacagcgagcctcccccggcacccggggcccagcgcgcacagatgggcc
  • Show more
Description: A cloning plasmid for the ZYX gene.

ZYX Rabbit pAb

A2135-100ul 100 ul
EUR 308

ZYX Rabbit pAb

A2135-200ul 200 ul
EUR 459

ZYX Rabbit pAb

A2135-20ul 20 ul
EUR 183

ZYX Rabbit pAb

A2135-50ul 50 ul
EUR 223

Anti-ZYX antibody

STJ26156 100 µl
EUR 277
Description: Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and along the actin cytoskeleton. Zyxin has an N-terminal proline-rich domain and three LIM domains in its C-terminal half. The proline-rich domain may interact with SH3 domains of proteins involved in signal transduction pathways while the LIM domains are likely involved in protein-protein binding. Zyxin may function as a messenger in the signal transduction pathway that mediates adhesion-stimulated changes in gene expression and may modulate the cytoskeletal organization of actin bundles. Alternative splicing results in multiple transcript variants that encode the same isoform.

Anti-ZYX antibody

STJ72081 100 µg
EUR 359

ZYX ORF Vector (Human) (pORF)

ORF012113 1.0 ug DNA
EUR 95

ZYX ELISA Kit (Human) (OKCA02157)

OKCA02157 96 Wells
EUR 833
Description: Description of target: Adhesion plaque protein. Binds alpha-actinin and the CRP protein. Important for targeting TES and ENA/VASP family members to focal adhesions and for the formation of actin-rich structures. May be a component of a signal transduction pathway that mediates adhesion-stimulated changes in gene expression.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.8 pg/mL

ZYX ELISA Kit (Human) (OKCD00316)

OKCD00316 96 Wells
EUR 831
Description: Description of target: Adhesion plaque protein. Binds alpha-actinin and the CRP protein. Important for targeting TES and ENA/VASP family members to focal adhesions and for the formation of actin-rich structures. May be a component of a signal transduction pathway that mediates adhesion-stimulated changes in gene expression (By similarity).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.061 ng/mL

ZYX ELISA Kit (Human) (OKEH08197)

OKEH08197 96 Wells
EUR 896
Description: Description of target: Focal adhesions are actin-rich structures that enable cells to adhere to the extracellular matrix and at which protein complexes involved in signal transduction assemble. Zyxin is a zinc-binding phosphoprotein that concentrates at focal adhesions and along the actin cytoskeleton. Zyxin has an N-terminal proline-rich domain and three LIM domains in its C-terminal half. The proline-rich domain may interact with SH3 domains of proteins involved in signal transduction pathways while the LIM domains are likely involved in protein-protein binding. Zyxin may function as a messenger in the signal transduction pathway that mediates adhesion-stimulated changes in gene expression and may modulate the cytoskeletal organization of actin bundles. Alternative splicing results in multiple transcript variants that encode the same isoform.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 29pg/mL

Zyxin (Phospho-Tyr316) Antibody

13247-100ul 100ul
EUR 252

Zyxin (Phospho-Tyr316) Antibody

13247-50ul 50ul
EUR 187

Zyxin (Phospho-Ser143) Antibody

13248-100ul 100ul
EUR 252

Zyxin (Phospho-Ser143) Antibody

13248-50ul 50ul
EUR 187

Rat Zyxin ELISA kit

E02Z0034-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Zyxin ELISA kit

E02Z0034-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Zyxin ELISA kit

E02Z0034-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Zyxin ELISA kit

E04Z0034-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Zyxin ELISA kit

E04Z0034-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Zyxin ELISA kit

E04Z0034-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Zyxin ELISA kit

E03Z0034-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Zyxin ELISA kit

E03Z0034-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Zyxin ELISA kit

E03Z0034-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Zyxin ELISA kit

E08Z0034-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Zyxin ELISA kit

E08Z0034-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Zyxin ELISA kit

E08Z0034-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Zyxin ELISA kit

E06Z0034-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Zyxin ELISA kit

E06Z0034-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Zyxin ELISA kit

E06Z0034-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Zyxin ELISA kit

E07Z0034-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Zyxin ELISA kit

E07Z0034-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Zyxin ELISA kit

E07Z0034-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Zyxin ELISA kit

E09Z0034-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Zyxin ELISA kit

E09Z0034-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Zyxin ELISA kit

E09Z0034-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Phospho-Zyxin (Tyr316) Antibody

AF7402 200ul
EUR 376
Description: Phospho-Zyxin (Tyr316) Antibody detects endogenous levels of Zyxin only when phosphorylated at Tyr316.

Phospho-Zyxin (Ser143) Antibody

AF7403 200ul
EUR 376
Description: Phospho-Zyxin (Ser143) Antibody detects endogenous levels of Zyxin only when phosphorylated at Ser143.

Anti-Zyxin Monoclonal Antibody

M02365 100ug
EUR 397
Description: Rabbit Monoclonal Zyxin Antibody. Validated in IP, IF, WB and tested in Human, Mouse.

Anti-Zyxin (2C10-4A7)

YF-MA16216 100 ug
EUR 363
Description: Mouse monoclonal to Zyxin

Phospho-ZYX (S142) Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-ZYX (S142). Recognizes Phospho-ZYX (S142) from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

Mouse ZYX shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ZYX sgRNA CRISPR Lentivector set (Human)

K2744501 3 x 1.0 ug
EUR 339

Guinea pig Zyxin ELISA kit

E05Z0034-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Zyxin ELISA kit

E05Z0034-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Zyxin ELISA kit

E05Z0034-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Zyxin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Phospho-Zyxin (Tyr316) Blocking Peptide

AF7402-BP 1mg
EUR 195

Phospho-Zyxin (Ser143) Blocking Peptide

AF7403-BP 1mg
EUR 195

Zyxin (Phospho-Tyr316) Conjugated Antibody

C13247 100ul
EUR 397

Zyxin (Phospho-Ser143) Conjugated Antibody

C13248 100ul
EUR 397

Phospho- Zyxin (Ser142/143) Antibody

ABF3801 100 ug
EUR 438

Zyxin (phospho Ser142) Polyclonal Antibody

ABP56555-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Zyxin around the phosphorylation site of S142
  • Applications tips:
Description: A polyclonal antibody for detection of Zyxin phospho Ser142) from Human. This Zyxin phospho Ser142) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Zyxin around the phosphorylation site of S142

Zyxin (phospho Ser142) Polyclonal Antibody

ABP56555-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Zyxin around the phosphorylation site of S142
  • Applications tips:
Description: A polyclonal antibody for detection of Zyxin phospho Ser142) from Human. This Zyxin phospho Ser142) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Zyxin around the phosphorylation site of S142

Zyxin (phospho Ser142) Polyclonal Antibody

ABP56555-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human Zyxin around the phosphorylation site of S142
  • Applications tips:
Description: A polyclonal antibody for detection of Zyxin phospho Ser142) from Human. This Zyxin phospho Ser142) antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Zyxin around the phosphorylation site of S142

Zyxin (phospho Ser142) Polyclonal Antibody

ES7554-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Zyxin (phospho Ser142) from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Zyxin (phospho Ser142) Polyclonal Antibody

ES7554-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Zyxin (phospho Ser142) from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CFP-Zyxin fusion Lentiviral particles

LVP449-C 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made lentiviral particles expressing (CFP-human Zyxin) fusion contruct under suCMV promoter, provided in DMEM medium with 10% FBS and 60ug/ml of polybrene.

GFP-Zyxin fusion Lentiviral particles

LVP449-G 1x107 IFU/ml x 200ul
EUR 451
Description: Pre-made lentiviral particles expressing (GFP-human Zyxin) fusion contruct under suCMV promoter, provided in DMEM medium with 10% FBS and 60ug/ml of polybrene.

DHPLC expertise for high-throughput detection of mutations in a durum wheat TILLING inhabitants


Durum wheat (Triticum turgidum L.) is a cereal crop broadly grown within the Mediterranean areas; the amber grain is especially used for the manufacturing of pasta, couscous and typical breads. Single nucleotide polymorphism (SNP) detection applied sciences and high-throughput mutation induction symbolize a brand new problem in wheat breeding to establish allelic variation in giant populations.

The TILLING technique makes use of conventional chemical mutagenesis adopted by screening for single base mismatches to establish novel mutant loci. Though TILLING has been mixed to a number of delicate pre-screening strategies for SNP evaluation, most depend on costly gear. Lately, a brand new low value and time saving DHPLC protocol has been utilized in molecular human diagnostic to detect unknown mutations.


On this work, we developed a brand new durum wheat TILLING inhabitants (cv. Marco Aurelio) utilizing 0.70-0.85% ethyl methane sulfonate (EMS). To analyze the effectivity of the mutagenic therapies, a pilot screening was carried out on 1,140 mutant traces specializing in two goal genes (Lycopene epsilon-cyclase, ε-LCY, and Lycopene beta-cyclase, β-LCY) concerned in carotenoid metabolism in wheat grains.

We simplify the heteroduplex detection by two low value strategies: the enzymatic cleavage (CelI)/agarose gel approach and the denaturing high-performance liquid chromatography (DHPLC). The CelI/agarose gel method allowed us to establish 31 mutations, whereas the DHPLC process detected a complete of 46 mutations for each genes.

All detected mutations had been confirmed by direct sequencing. The estimated total mutation frequency for the pilot assay by the DHPLC methodology resulted to be of 1/77 kb, representing a excessive chance to detect fascinating mutations within the goal genes.


We demonstrated the applicability and effectivity of a brand new technique for the detection of induced variability. We produced and characterised a brand new durum wheat TILLING inhabitants helpful for a greater understanding of key gene features. The supply of this instrument along with TILLING approach will develop the polymorphisms in candidate genes of agronomically essential traits in wheat.

Range of the microbiota concerned in wine and natural apple cider submerged vinegar manufacturing as revealed by DHPLC evaluation and next-generation sequencing

Unfiltered vinegar samples collected from three oxidation cycles of the submerged industrial manufacturing of every, crimson wine and natural apple cider vinegars, had been sampled in a Slovene vinegar producing firm. The samples had been systematically collected from the start to the top of an oxidation cycle and used for culture-independent microbial analyses carried out by denaturing excessive stress liquid chromatography (DHPLC) and Illumina MiSeq sequencing of 16S rRNA gene variable areas.

Each approaches confirmed a really homogeneous bacterial construction throughout wine vinegar manufacturing however extra heterogeneous throughout natural apple cider vinegar manufacturing. In all wine vinegar samples Komagataeibacter oboediens (previously Gluconacetobacter oboediens) was a predominating species. In apple cider vinegar the acetic acid and lactic acid micro organism had been two main teams of micro organism.

The acetic acid bacterial consortium was composed of Acetobacter and Komagataeibacter with the Komagataeibacter genus outcompeting the Acetobacter in all apple cider vinegar samples on the finish of oxidation cycle. Among the many lactic acid bacterial consortium two dominating genera had been recognized, Lactobacillus and Oenococcus, with Oenococcus prevailing with growing focus of acetic acid in vinegars. Unexpectedly, a minor genus of the acetic acid bacterial consortium in natural apple cider vinegar was Gluconobacter, suggesting a potential improvement of the Gluconobacter inhabitants with a tolerance in opposition to ethanol and acetic acid. Among the many accompanying micro organism of the wine vinegar, the genus Rhodococcus was detected, however it decreased considerably by the top of oxidation cycles

Human Annexin A2 (ANXA2) ELISA Kit

RDR-ANXA2-Hu-48Tests 48 Tests
EUR 522

Human Annexin A2 (ANXA2) ELISA Kit

RDR-ANXA2-Hu-96Tests 96 Tests
EUR 724

Human Annexin A2 (ANXA2) ELISA Kit

RD-ANXA2-Hu-48Tests 48 Tests
EUR 500

Human Annexin A2 (ANXA2) ELISA Kit

RD-ANXA2-Hu-96Tests 96 Tests
EUR 692

Mouse Annexin A2 (ANXA2) ELISA Kit

DLR-ANXA2-Mu-48T 48T
EUR 508
  • Should the Mouse Annexin A2 (ANXA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Annexin A2 (ANXA2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Annexin A2 (ANXA2) ELISA Kit

DLR-ANXA2-Mu-96T 96T
EUR 661
  • Should the Mouse Annexin A2 (ANXA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Annexin A2 (ANXA2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Annexin A2 (ANXA2) ELISA Kit

DLR-ANXA2-Ra-48T 48T
EUR 528
  • Should the Rat Annexin A2 (ANXA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Annexin A2 (ANXA2) in samples from serum, plasma or other biological fluids.

Rat Annexin A2 (ANXA2) ELISA Kit

DLR-ANXA2-Ra-96T 96T
EUR 690
  • Should the Rat Annexin A2 (ANXA2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Annexin A2 (ANXA2) in samples from serum, plasma or other biological fluids.

Mouse Annexin A2 (ANXA2) ELISA Kit

RDR-ANXA2-Mu-48Tests 48 Tests
EUR 534

Mouse Annexin A2 (ANXA2) ELISA Kit

RDR-ANXA2-Mu-96Tests 96 Tests
EUR 742

Rat Annexin A2 (ANXA2) ELISA Kit

RDR-ANXA2-Ra-48Tests 48 Tests
EUR 558

Rat Annexin A2 (ANXA2) ELISA Kit

RDR-ANXA2-Ra-96Tests 96 Tests
EUR 776

Mouse Annexin A2 (ANXA2) ELISA Kit

RD-ANXA2-Mu-48Tests 48 Tests
EUR 511

Mouse Annexin A2 (ANXA2) ELISA Kit

RD-ANXA2-Mu-96Tests 96 Tests
EUR 709

Rat Annexin A2 (ANXA2) ELISA Kit

RD-ANXA2-Ra-48Tests 48 Tests
EUR 534

Rat Annexin A2 (ANXA2) ELISA Kit

RD-ANXA2-Ra-96Tests 96 Tests
EUR 742

Recombinant Annexin A2 (ANXA2)

  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P07355
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01%skl, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.1kDa
  • Isoelectric Point: 6.7
Description: Recombinant Human Annexin A2 expressed in: E.coli

Recombinant Annexin A2 (ANXA2)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P07356
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.0kDa
  • Isoelectric Point: 9
Description: Recombinant Mouse Annexin A2 expressed in: E.coli

Recombinant Annexin A2 (ANXA2)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q07936
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Annexin A2 expressed in: E.coli

Annexin A2/ANXA2

E21-205 10ug
EUR 343

Human Annexin A2 (ANXA2)

  • EUR 293.00
  • EUR 963.00
  • EUR 409.00
  • EUR 717.00
  • 100ug
  • 1MG
  • 200ug
  • 500ug
  • MW: 42.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Annexin A2(ANXA2) expressed in Mammalian cell

Human Annexin A2 (ANXA2)

  • EUR 437.00
  • EUR 238.00
  • EUR 1544.00
  • EUR 653.00
  • EUR 1029.00
  • EUR 296.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 54.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Annexin A2(ANXA2) expressed in E.coli

Human Annexin A2 (ANXA2)

  • EUR 437.00
  • EUR 238.00
  • EUR 1544.00
  • EUR 653.00
  • EUR 1029.00
  • EUR 296.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 42.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Annexin A2(ANXA2) expressed in E.coli

Human Annexin A2 (ANXA2)

  • EUR 437.00
  • EUR 238.00
  • EUR 1544.00
  • EUR 653.00
  • EUR 1029.00
  • EUR 296.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 57 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Annexin A2(ANXA2) expressed in E.coli

Human Annexin A2 (ANXA2)

  • EUR 437.00
  • EUR 238.00
  • EUR 1544.00
  • EUR 653.00
  • EUR 1029.00
  • EUR 296.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 65.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Annexin A2(ANXA2) expressed in E.coli

ANXA2 Annexin A2 Human Recombinant Protein

PROTP07355 Regular: 20ug
EUR 317
Description: ANXA2 Human Recombinant produced in E.Coli is a single, non-glycosylated,_x000D_ polypeptide chain containing 376 amino acids (1-339a.a.) and having a molecular mass of 42.8 kDa. ANXA2 is fused to a 37 amino acid His-Tag at N-Terminus and purified by proprietary chromatographic techniques._x000D_

Active Annexin A2 (ANXA2)

  • EUR 777.38
  • EUR 311.00
  • EUR 2640.16
  • EUR 946.72
  • EUR 1793.44
  • EUR 583.00
  • EUR 6450.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P07356
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.0kDa
  • Isoelectric Point: 9
Description: Recombinant Mouse Annexin A2 expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells

Annexin A2 (ANXA2) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Antibody

  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Annexin A2 (ANXA2) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Annexin A2 (ANXA2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Annexin A2 (ANXA2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Antibody

abx037777-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Antibody

abx048475-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Annexin A2 (ANXA2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Antibody

abx146593-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Antibody

abx146597-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Antibody

  • EUR 328.00
  • EUR 815.00
  • EUR 425.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.

Annexin A2 (ANXA2) Antibody

  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Annexin A2 (ANXA2) Antibody

abx033386-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Antibody

abx033386-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Antibody

abx033387-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Antibody

abx033387-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Protein

  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Protein

  • EUR 230.00
  • EUR 1609.00
  • EUR 328.00
  • 1 µg
  • 50 ug
  • 5 ug
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Antibody

abx431134-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Annexin A2 (ANXA2) Antibody

abx230430-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Annexin A2 (ANXA2) Antibody

abx230431-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Annexin A2 (ANXA2) Antibody

abx230432-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Annexin A2 (ANXA2) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human Annexin A2 (ANXA2) Protein

  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ANXA2 Annexin A2 Human protein

PROTP07355-1 Regular: 5ug
EUR 317
Description: The Human Annexin A2 produced from Human Adipose Tissue has a molecular mass of 38.472kDa (calculated without glycosylation) containing 338 amino acid residues.

Annexin A2 (ANXA2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Annexin A2 (ANXA2) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Annexin A2 (ANXA2) Antibody (Biotin)

  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Annexin A2 (ANXA2) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Annexin A2 (ANXA2) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Annexin A2 (ANXA2) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Annexin A2/ANXA2 Antibody

PA1348 100ug/vial
EUR 334

Human Annexin A2,Anxa2 ELISA Kit

201-12-1089 96 tests
EUR 440
  • This Annexin A2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human ANXA2/ Annexin A2 ELISA Kit

E0159Hu 1 Kit
EUR 571

Human Annexin A2 (ANXA2) CLIA Kit

  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Annexin A2 (ANXA2) CLIA Kit

abx195131-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Annexin A2 (ANXA2) ELISA Kit

  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Annexin A2 (ANXA2) ELISA Kit

abx251337-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human ANXA2(Annexin A2) ELISA Kit

EH2012 96T
EUR 524.1
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: P07355
  • Alias: ANXA2/Annexin A2/Lipocortin II/Chromobindin-8/Calpactin-1 heavy chain/Calpactin I heavy chain/p36/Protein I/Placental anticoagulant protein IV/PAP-IV/Annexin II/Annexin-2/ANX2/ANX2L4/CAL1H/LPC
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human Annexin A2, ANXA2 ELISA KIT

ELI-06247h 96 Tests
EUR 824

Human Annexin A2 (ANXA2) ELISA Kit

abx573296-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Annexin A2(Anxa2)ELISA Kit

GA-E1105HM-48T 48T
EUR 289

Human Annexin A2(Anxa2)ELISA Kit

GA-E1105HM-96T 96T
EUR 466

Human Annexin A2(Anxa2)ELISA Kit

QY-E02150 96T
EUR 361

Human Annexin A2 ELISA Kit (ANXA2)

RK00900 96 Tests
EUR 521

Human Annexin A2 (ANXA2)CLIA Kit

SCB944Hu-10x96wellstestplate 10x96-wells test plate
EUR 5647.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Annexin A2 (ANXA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Annexin A2 (ANXA2) in serum, plasma and other biological fluids.

Human Annexin A2 (ANXA2)CLIA Kit

SCB944Hu-1x48wellstestplate 1x48-wells test plate
EUR 552.76
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Annexin A2 (ANXA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Annexin A2 (ANXA2) in serum, plasma and other biological fluids.

Human Annexin A2 (ANXA2)CLIA Kit

SCB944Hu-1x96wellstestplate 1x96-wells test plate
EUR 746.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Annexin A2 (ANXA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Annexin A2 (ANXA2) in serum, plasma and other biological fluids.

Human Annexin A2 (ANXA2)CLIA Kit

SCB944Hu-5x96wellstestplate 5x96-wells test plate
EUR 3060.6
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Annexin A2 (ANXA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Chemiluminescent immunoassay for detection of Human Annexin A2 (ANXA2) in serum, plasma and other biological fluids.

Human Annexin A2 (ANXA2) CLIA Kit

  • EUR 5698.00
  • EUR 3061.00
  • EUR 747.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Annexin A2 Clia kit. Alternative names of the recognized antigen: ANX-A2
  • ANX2L4
  • CAL1H
  • LIP2
  • LPC2
  • LPC2D
  • P36
  • PAP-IV
  • Protein I
  • Chromobindin-8
  • Calpactin-1 heavy chain
  • Lipocortin II
  • Placental anticoagulant protein IV
Description: Double-antibody Sandwich chemiluminescent immunoassay for detection of Human Annexin A2 (ANXA2)Serum, plasma and other biological fluids

Human Annexin A2 (ANXA2) ELISA Kit

SEB944Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Annexin A2 (ANXA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Annexin A2 (ANXA2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Annexin A2 (ANXA2) ELISA Kit

SEB944Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Annexin A2 (ANXA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Annexin A2 (ANXA2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Annexin A2 (ANXA2) ELISA Kit

SEB944Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Annexin A2 (ANXA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Annexin A2 (ANXA2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Annexin A2 (ANXA2) ELISA Kit

SEB944Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Annexin A2 (ANXA2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Annexin A2 (ANXA2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Annexin A2 (ANXA2) ELISA Kit

  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Annexin A2 elisa. Alternative names of the recognized antigen: ANX-A2
  • ANX2L4
  • CAL1H
  • LIP2
  • LPC2
  • LPC2D
  • P36
  • PAP-IV
  • Protein I
  • Chromobindin-8
  • Calpactin-1 heavy chain
  • Lipocortin II
  • Placental anticoagulant protein IV
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Annexin A2 (ANXA2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Annexin A2 (ANXA2) CLIA Kit

abx195132-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Annexin A2 (ANXA2) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Annexin A2 (ANXA2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Annexin A2 (ANXA2) ELISA Kit

abx255184-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Annexin A2, Anxa2 ELISA KIT

ELI-06242m 96 Tests
EUR 865

Chicken Annexin A2, ANXA2 ELISA KIT

ELI-06244c 96 Tests
EUR 928

Porcine Annexin A2, ANXA2 ELISA KIT

ELI-06245p 96 Tests
EUR 928

Bovine Annexin A2, ANXA2 ELISA KIT

ELI-06248b 96 Tests
EUR 928

Monkey Annexin A2 (ANXA2) ELISA Kit

abx359506-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Annexin A2 (ANXA2) ELISA Kit

abx361278-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Annexin A2 (ANXA2) ELISA Kit

abx356138-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Annexin A2 (ANXA2) ELISA Kit

abx363383-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Annexin A2 (ANXA2) ELISA Kit
